Skip to Main Content
CWRU Links

School of
Medicine

Genomics Core

Sanger Sequencing

Sanger Sequencing

We Provide Quality Sequencing Data

Dye-terminator sequencing is performed using a modified protocol supplied by Applied Biosystems BigDye Terminator 1.1 and 3.1 Cycle sequencing kits. All reactions are analyzed using a 48-capillary 3730 Genetic Analyzer. Sanger Sequencing can be performed on a variety of templates including PCR product, plasmids, and BACs for analysis of mutation detection and traditional DNA sequencing. Microsatellite Genotyping is also supported by the Core and run on the 3730 Genetic Analyzer.

The Genomics Core offers quality sequencing data, with a fast turn-around time, and knowledgeable help with troubleshooting. Discounts are available for large projects.

View of the 3730 Genetic Analyzer on a desk.

Sample Submission:

  • The Genomics Core is now transitioning all service requests over to iLab Operations Software, a part of Agilent Technologies’ CrossLab platform. This is an online system to streamline the process of ordering and billing for core service requests. 

    In order to gain access to your funds you will need to begin by logging into iLab at the following web address:

    https://cwru.corefacilities.org

    Once an account is created, the Genomics Core ordering site can be found here:

    https://cwru.corefacilities.org/service_center/show_external/4142?name=genomics-core-facility

    Simply click on Request Services tab to begin. 
  • Bring your samples to the Core Welcome Center, Wood Building Room 106.
  • Samples are processed on Monday and Thursday mornings (9am) and data will be released the next day.
  • Samples and primers must be submitted in separate tubes. NO STRIP TUBES.
  • Clearly label each tube with the appropriate name, the date, and your name / initials.
  • Large sets of samples can be submitted in a 96-well plate format with a volume of 10ul per reaction. (There is a price reduction for processing more than 96 reactions at a time.)
  • EXO-SAP service to clean-up PCR products is available @ $1 per reaction. Provide 10ul of PCR product.
Type of TemplateQuantity
Plasmid 100 – 300ng per reaction
Short PCR product (<500bp) 50 – 100ng per reaction
Long PCR product (>500bp) 100 – 200ng per reaction
BAC 1ug per reaction
Primer 2ul of 20uM concentration per reaction

Primers

  • All primers must be submitted in separate tubes at a 20uM concentration
  • Clearly label each primer with the appropriate name, the date and your name / initials.
  • Provide at least 2ul of primer per reaction and list an annealing temperature on the request form.
  • The Genomics Core does offer universal primers at no cost to the user.

Universal primers stocked by the Core

NameSequence
BGH reverse 5’ TAGAAGGCACAGTCGAGG
CMV-for 5’ CGCAAATGGGCGGTAGGCGTG
GLprimer1 5’ TGTATCTTATGGTACTGTAACTG
GLprimer2 5’ CTTTATGTTTTTGGCGTCTTCC
M13 Forward 5’ GTTTTCCCAGTCACGAC
M13 Reverse 5’ AACAGCTATGACCATG
pGEX 3′ CCGGGAGCTGCATGTGTCAGAGG
pGEX 5′ GGGCTGGCAAGCCACGTTTGGTG
SP6 5’ ATTTAGGTGACACTATA
T3 5’ AATTACCCTCACTAAAGGG
T7 promoter 5’ TAATACGACTCACTATAGGG
T7 terminator GCTAGTTATTGCTCAGCGGT

Fragment Analysis

Fragment Analysis, or microsatellite genotyping, is analyzed using the Applied Bio Systems 3730 Genomic Analyzer. Samples should be brought to the Core post-PCR for analysis. Fill out the Microsatellite/Genotyping Request Form (PDF) and bring to room 747 of the Biomedical Research Building (BRB). Samples should be in plate format with a minimum of 10ul volume. The Core is capable of analyzing dye sets 6-FAM, HEX, NED, ROX, VIC, and PET using a LIZ500-basepair standard or the LIZ600-basepair standard. SNaPshot analysis is also available.

Results

Data is released to users via Google Drive. A folder is created per PI and user and is shared directly with the user. Once a folder share has been accepted, the run files can be downloaded for further analysis. Data will not permanently remain on Google Drive and should be archived by the user, however the Core will have access to backups of sanger sequencing data.